A practical reference on lyophilisation: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2026-01-15. Anything still debated is marked as such rather than presented as settled.
The copper-binding activity of this sequence was described in the 1970s during studies of liver tissue and plasma factors. Early work identified the peptide as a component that influenced copper uptake by cells and that appeared in wound fluid. Later investigations examined its presence across species, reporting the same chain in human and animal samples. A decline in measured concentration with age became a recurring observation, although the underlying causes remain incompletely characterised.
Published studies describe the complex in several research contexts, including collagen synthesis, antioxidant behaviour, and wound repair models. Much of this work is conducted in cultured cells or in small animal systems, and the findings are frequently cited in reviews of copper peptides. Direct clinical evidence in humans is comparatively limited, and reported outcomes vary with formulation and study design. Whether free chain or metal-bound form was used is not always stated, a point that complicates comparison between reports.
Analytical verification commonly relies on high-performance liquid chromatography for purity assessment and mass spectrometry for identity confirmation. Spectroscopic methods such as UV-visible absorption and electron paramagnetic resonance can probe the metal centre itself, since the d9 configuration of copper(II) produces characteristic signals. Elemental analysis or plasma-based techniques quantify copper content. Because each method reports a different aspect of the same sample, purity figures are most meaningful when the technique and its detection wavelength are stated alongside the value.
Stability of the complex in solution depends on pH, temperature, and the presence of competing ligands. It is generally described as more resistant to breakdown than the metal-free chain, since coordination reduces susceptibility to enzymatic attack. Oxidation and hydrolysis can nevertheless proceed over time in aqueous media. Storage guidance in laboratory settings commonly involves refrigeration, protection from light, and avoidance of strongly alkaline conditions. Published data on long-term behaviour vary considerably and depend on the specific matrix.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Copper(II) peptide complex | Coordination compound rather than a simple salt |
| Peptide sequence | Glycyl-L-histidyl-L-lysine | Abbreviated GHK in most literature |
| Molecular formula | C14H22N6O4Cu | Reported for the 1:1 complex |
| Principal binding site | Histidine imidazole nitrogen | Backbone amides contribute additional coordination |
| Common synonym | Copper tripeptide-1 | Used in ingredient and product labelling |
Endogenous GHK occurs in blood plasma, saliva, and urine, and reported plasma concentrations decline with age in several studies. Researchers have proposed that the peptide acts as a copper carrier that delivers the metal to cells and to sites of injury. That transport role is a hypothesis supported by binding measurements and tissue-distribution data rather than a settled mechanism, and the peptide is generally described as a minor contributor to total plasma copper transport. Values reported in wound fluid and certain tissue extracts are higher than in circulating plasma.
The sequence carries three residues in the order glycine, histidine, lysine, which places a small, flexible chain around a single metal centre. Compared with larger copper-binding proteins, the complex is compact and its coordination chemistry can be reproduced with synthetic peptide in a laboratory. Published structural work agrees on the nitrogen donor set but differs in the exact geometry assigned under some conditions, so the arrangement is best treated as well characterised in outline rather than fixed in every detail.
Routine characterisation relies on reversed-phase high-performance liquid chromatography for peptide purity, paired with mass spectrometry for identity confirmation. Ultraviolet-visible spectroscopy detects the metal centre through its absorption band in the visible region, and inductively coupled plasma mass spectrometry quantifies total copper so that a metal-to-peptide ratio can be calculated. Amino acid analysis confirms the expected residue composition. Together these techniques establish concentration, identity, and stoichiometry, but none of them directly reports biological activity.
Quality specifications for research material commonly state peptide purity, copper stoichiometry, counter-ion identity, and residual water content. Frequent counter-ions include acetate and trifluoroacetate, which differ in mass and in their effect on solubility and handling. Whether batch-to-batch differences in reported responses trace to these parameters or to assay conditions remains an open question, since published comparisons rarely control for all of them at once. Independent verification therefore normally pairs a purity measurement with an elemental copper measurement on the same lot.
Practical handling notes centre on limiting exposure to water, oxygen, and repeated temperature cycling. Weighed powder is often equilibrated to room temperature before opening to avoid condensation on the solid. Working solutions are typically divided into single-use aliquots and frozen rather than stored refrigerated for long periods. Reported shelf lives vary widely between laboratories, and no single set of conditions is universally treated as a reference standard, which complicates direct comparison of published stability figures.
GHK-Cu is a coordination complex formed from the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide binds copper through its histidine imidazole nitrogen, the terminal amino group, and the deprotonated amide nitrogen. This arrangement creates a square-planar or distorted geometry around the metal center, depending on pH and the presence of competing ligands. The complex occurs naturally in human plasma, saliva, and urine at low concentrations, and its sequence is conserved across many vertebrate species.
Discovery of GHK is generally attributed to work in the 1970s that isolated a plasma factor influencing liver cell behavior. Subsequent studies identified the copper-binding tripeptide and its ability to chelate copper with high affinity. Early reports linked the complex to wound healing and tissue remodeling in animal models. The free peptide and the copper-bound form have different properties, so the two are distinguished in the literature. Whether endogenous GHK-Cu serves a single primary physiological role remains an open question.
=== Media coverage === The many murders which were carried out by the Moroccan mafia were a turning point in criminal journalism across Belgium and the Netherlands. Although the Moroccan mafia is not the first criminal phenomenon in these countries, it is the first to receive both international and intensive media coverage. The Dutch virtual tax reforms of the 2010s encouraged the emergence of inexpensive print media, which could therefore be widely distributed and relayed. These broadcasts were the precursors of a trend that gained momentum after the assassination of journalist Martin Kok in 2016. The Dutch newspaper De Telegraaf benefited greatly from the public enthusiasm for the criminal war that was taking place in its cities, which received unprecedented media coverage. While some Dutch media outlets decided to censor the first and last names of the editors who published articles, other news outlets like De Telegraaf did not give into the panic, and refused to practice censorship. After the attacks on De Telegraaf and Panorama in 2017, lawyer Christien Wildeman stated:
== Functional protein microarrays == Functional protein microarrays (also known as target protein arrays) are constructed by immobilising large numbers of purified proteins and are used to identify protein–protein, protein–DNA, protein–RNA, protein–phospholipid, and protein–small-molecule interactions, to assay enzymatic activity and to detect antibodies and demonstrate their specificity. They differ from analytical arrays in that functional protein arrays are composed of arrays containing full-length functional proteins or protein domains. These protein chips are used to study the biochemical activities of the entire proteome in a single experiment. The key element in any functional protein microarray-based assay is the arrayed proteins must retain their native structure, such that meaningful functional interactions can take place on the array surface. The advantages of controlling the precise mode of surface attachment through use of an appropriate affinity tag are that the immobilised proteins will have a homogeneous orientation resulting in a higher specific activity and higher signal-to-noise ratio in assays, with less interference from non-specific interactions.
The synthetic opioid ketazocine and terpenoid natural product salvinorin A are potent and selective KOR agonists. The KOR also mediates the dysphoria and hallucinations seen with opioids such as pentazocine.
Butonitazene is a benzimidazole derivative with opioid effects, which has been sold over the internet as a designer drug. It has relatively low potency compared to many related compounds, and has generally been encountered as a component of mixtures with other substances rather than in its pure form. However, it is still several times the potency of morphine and has been implicated in several cases of drug overdose. Butonitazene is a Schedule I drug in the US, along with several related compounds.
Obesity is a risk factor for certain conditions, including diabetes, cancer, cardiovascular disease, high blood pressure, and non-alcoholic fatty liver disease. Reduction of obesity lowers those risks. A 1 kilogram (2.2 lb) loss of body weight has been associated with an approximate 1 millimetre of mercury (0.13 kPa) drop in blood pressure. Intentional weight loss is associated with cognitive performance improvements in overweight and obese individuals.
Sources: en.wikipedia.org
=== Serotonergic agents and serotonin syndrome === Combination of trazodone with selective serotonin reuptake inhibitors (SSRIs), tricyclic antidepressants (TCAs), or monoamine oxidase inhibitors (MAOIs) has a theoretical risk of serotonin syndrome. However, trazodone has been studied in combination with SSRIs and seemed to be safe in this context. On the other hand, cases of excessive sedation and serotonin syndrome have been reported with a combination of trazodone and fluoxetine or paroxetine. This may be due to the combined potentiation of the serotonin system. Or it may be related to the inhibition of cytochrome P450 enzymes by fluoxetine and paroxetine and consequently increased trazodone and mCPP levels.
On 3 January, the Federal Aviation Authority banned US commercial flights from flying over Venezuela, citing "ongoing military activity" as explosions hit Caracas at around 2 AM. Venezuela's government confirmed attacks in Caracas, as well as in Miranda, La Guaira and Aragua. Eyewitnesses reported strikes on airports and military airfields and bases. The following day, the United States announced that it had captured Maduro during a raid on Caracas. Trump said that the United States would "run" Venezuela pending a transition of power.
=== Traditional isotope systems === The compounds used as isotopic references have a relatively complex history. The broad evolution of reference materials for the hydrogen, carbon, oxygen, and sulfur stable isotope systems are shown in Figure 1. Materials with red text define the primary reference commonly reported in scientific publications and materials with blue text are those available commercially. The hydrogen, carbon, and oxygen isotope scales are defined with two anchoring reference materials. For hydrogen the modern scale is defined by VSMOW2 and SLAP2, and is reported relative to VSMOW. For carbon the scale is defined by either NBS-19 or IAEA-603 depending on the age of the lab, as well as LSVEC, and is reported relative to VPDB. Oxygen isotope ratios can be reported relative to either the VSMOW or VPDB scales. The isotopic scales for sulfur and nitrogen are both defined for only a single anchoring reference material. For sulfur the scale is defined by IAEA-S-1 and is reported relative to VCDT, while for nitrogen the scale is both defined by and reported relative to AIR.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== Menu options === The menus below are adapted from lists available on the website of the Defense Logistics Agency (DLA). UGR menus are regularly modified to improve their variety, nutrition, and efficiency. As the DLA does not regularly publish UGR menus. The lists below use the 2020 menu for the UGR-H&S, 2023 menu for the UGR-A, 2014 menu for the UGR-M, and 2021 menu for the UGR-E. Note that the lists below do not include milk, bread, fruit, or salad supplements, or items standard to most UGRs such as regular coffee and hot sauce.
Sources: en.wikipedia.org
GHK denotes the unbound chain of three amino acids. GHK-Cu describes the form in which a copper(II) ion is held by that chain. The two are not interchangeable in solution, since charge, molecular weight, and reactivity differ.
The chain occurs in human plasma, saliva, and urine. Measured amounts are reported to fall with age. Copper binding by the sequence is treated as part of normal metal handling in tissue.
The bound copper(II) centre contributes to redox behaviour and to stability under physiological conditions. Free copper ions can participate in reactions that generate reactive species, while chelated metal is generally more controlled. The chain may also serve as a carrier for copper in experimental systems.
Reverse-phase high-performance liquid chromatography with ultraviolet detection is the most common approach. Purity is expressed as a share of total peak area at a specified wavelength. Mass spectrometry is then used to confirm molecular identity.